Archive for March 2008
Meaningless Nothingness
I thought i have been writing meaningless stuffs all this while … until i came across Plato’s classical question ‘Why Is There Something Rather than Nothing?’. That’s the real deal of meaninglessness i can tell you.
To answer these sort of questions, you will have to stretch meaninglessness to the limit because it is actually pretty impossible to answer such question with brute facts due to the limitation of human mind and technology we have at the moment. But since this blog is about meaninglessness, i guess i will tag along and join the meaningless bandwagon.
The universe exists and we are not surprised.
The universe exists and we are surprised.
The universe does not exist and we are surprised.
The universe does not exist and we are not surprised.(by Zen Koan)
Look at the flower outside your house. Why does the flower on the garden exist rather than do not exist? Now, shift your perspective and look inside your house. Why does flower do not grow on the floor inside your house?
To bring fourth the existence of flower, you need the seed, earth, water, sunlight, cloud, the right weather conditions, etc. If all the right elements and factors are there, the flower will exist. If even one of the elements is missing, the flower will not exist.
This brings to the realization that there is absolutely nothing in this world which is unique and independent on its own. Every single entity are dependent on other elements in order to exist. As i see it, the grand nature works in an inconceivable-enormous-cycle. Different elements spark various reactions to bring fourth something from scratch permitted by nature’s law (or science).
Example: The cloud do not exist. But when the sun absorb water from the earth, the liquid turns into vapor and form a cloud. Now, the cloud exist.
Therefore, my point here is :
’something’ exist.
’something’ do not exist.
‘nothing’ exist.
‘nothing’ do not exist.
I did not exist 100 years ago. I will not exist 100 years later. I exist now. Why do i exist? It is because there are factors and elements which brought me to existence. My life is not given but its just a temporal state of being. Other factors and elements will dictate when my life will end. When i die, my existence will cease and i go back to where i came from which is – nothingness. My life does not start from nothing and cease to nothing, rather my life is a cycle. I can also apply this philosophical implication to the Universe, which is the ultimate source of all existence.
Going back to the question, Plato has separated ’something’ with ‘nothing.’ Why do we always want to separate ’something’ and ‘nothing’? We always perceive ’something’ is more valuable than ‘nothing’ and we always seek to choose ’something’ to overcome ‘nothing’. It is always in human’s psyche. I wonder, is this an inherent sense within us or a psychological bias/defect?
Just like a coin where head and tail co-exist and complement each other, i believe something and nothing exist together to harmonize the nature.
Neuroscience’s Will
There’s something pretty amazing i wanna share about Neuroscience.
Before we go into the topic, let’s take a scenario first. Let’s say you are thirsty and you want to drink some water. You have decided to get up, go to the kitchen and grab a glass of water. From your point of view, did you just make a conscious action? You may say yes, because you think you have CHOOSEN the decision whether to grab a cup of water or not. And that represents free will in action – You can simply choose to drink or not to drink.
However, from Neuroscience point of view, many things are pre-determined. In an experiment by Benjamin Libet, he founded out that our actions were always first initiated by our subconscious mind and then only translated to conscious actions. For example, my subconscious mind is already giving out instructions to my body to execute the action, 500 milliseconds before i consciously extend my hand to reach the glass. The reason why i have the feeling of consciously choosing my actions is due to retrospective point of view (which means contemplating back the past that happened split seconds ago).
Do you clearly remember your experience of brushing your teeth before going to bed last night? You probably won’t remember the experience. This is the case of our mind going ‘auto-pilot’. Since this is just a simple task, our subconscious mind automatically gives out the instructions to our body and paste a little note to our conscious mind saying ‘this body is going to brush his/her teeth’. That’s how we thought we have the conscious experience of choosing. The truth is, we are in ‘autopilot’ state and there’s not much choices to make.
Nevertheless, our conscious mind has the right to ‘veto’ the instructions given out by our mind. Conscious mind attempt to be a “Quality Control” to all the “tough” decisions made by the subconscious mind by giving ourselves more alternatives in considerations. Have you ever come across a situation where you are stuck between two options? Subconsciously, you want to get yourself a BMW for a car but consciously, you know you only have enough money for a Toyota. But then you may think, if you could work a little harder and be a little more thrifty, you may be able to get a BMW instead. And that’s how our mind clashed.
In other words, our subconscious and conscious mind will clash over tough and complex decisions such as buying a car while we will go autopilot on simple and easy decisions such as brushing our teeth or drinking water.
In Buddhism, emotions is said to be an illusion. All forms of emotions are unreal, except for happiness (you need to separate happiness with satisfaction). Emotions are something which is expressed spontaneously and instinctively by our mind in order to protect ourselves for survival purposes.
I’m sure you will have experienced certain situations where you got really pissed angry and on the next day, when everything cools down, you will feel it’s kinda unnecessary to get angry at silly things. It is simple – our subconscious mind unleashed the anger, and your conscious mind question the outburst.
That’s why according to Buddhism, in order to be enlightened, you need to control your mind instead of letting the mind control you.
Case in point – my subconscious mind is lusting over Crisis Core : Final Fantasy 7 now and my conscious mind could not overpower my subconscious mind! My body, a form of transportation for the almighty brain, is being manipulated to grab the PSP over and over again. I gotta go. My body needs to move away from the computer. Talk soon. =P
Conversation with Ronn : Religion and God.
Q: Good evening, Ronn. Can you tell me a little bit about yourself?
Me: My English name is Ronn, surname is Yeo and Chinese name is Zhiyuan. You can address me any of them …. hopefully it is not too complicated =P. I’m 22 years of age, graduated with a Marketing degree 6 months ago. I hold strong interest in science and philosophy area and i self-learned them via the internet and books. I have put very much effort in them and so far i’ve conceived many decent ideas. I’ve some thoughts of doing PhDs in these areas but i’m not over too serious about it at the moment. I’m also an atheist.
Q: As an atheist, do you hate religion?
Me: No, not at all. I think religions offer many positive things in terms of spiritual aspect. Moreover, I think the existing code of morality which make up the laws we have at the moment were influenced heavily by religion. You see, I don’t believe religion bring violence to the world as advocated by Richard Dawkins. It is not the problem of religion really, but rather it is a human problem. Human are violent and brutal by nature if the situation required us to be so. Have you heard of the psychological term ‘the power of situation’ before?
However, the only main problem i have with religion is that they often use God as an explanation for every difficult and challenging questions. Using God as reference to every subject, to me, is the ultimate insult to all intellectual, logical and critical discourse. As i have said many times before, you can never logically argue against omnipotent being who has infinite power because infinity itself never exist in the natural world. Plus, it is always annoying that people hijack the supernatural power to make the so called logical argument. For example, “God can create the world in a blink of an eye because he can. He is omnipotent, he can do whatever he wanted to.”
I think that’s extremely lazy habit of thinking.
So, putting it briefly, i’m ok with religion but not with the concept of God. But since both of them come in a package and inseparable, whenever i criticize the concept of God, inevitably i will touch about religion.
Q: Why do you think so many people in this world believe in God?
Me: Our imaginations. Without human imagination, we would never progress from stone age period to the modern era today. Imagination is also what separates us from animals which brought us so much more diversity to our daily life rather than just living in a typical sleep-eat-play-sex-eat-sleep of animal routine.
But here is the catch – According to Ying and Yang (Taoism) philosophy, whether we realize or not, every single phenomenon in this world will always have two sides of forces. Putting it simply, everything in this world has pros and cons in order to harmonize the nature. And i’m a strong believer in that philosophy.
Hence, imagination works as a double edge sword to humanity. Our imagination brings us many ideas, right from super-creative world changing ideas to over-fantasized ideas. And i will put God in the same category as over-fantasized ideas.
Q: Many religious people claimed that they always felt the presence of God around them. Does imagination play any role here?
Me: Allow me to illustrate my point by telling you a personal short true story of mine.
You see, I was born to a single parent family and my mum is a strong believer of Buddhism (Mahayana). Since the day i was born, money had been a problem as my mum did not have strong education qualification to get herself a decent pay job. Although she struggled very much financially, particularly when i was 1 up to 10 years old, i have never live a day where i was bothered by hunger. Magically it may sound, but money seems to come pretty naturally for her all this while to support our needs and stomach. She related to me before of how she prayed to the deity Guan Yin (a Mahayana deity) when i was younger and she always felt blessed that her wishes were always granted. Everything seemed to fell into places nicely for her. She believed it must be some divine influence.
I grew interested with Buddhism as i age, and the more i read, the more i realized Buddhism is more of a philosophy rather than a religion. There’s absolutely no God or divine being in Buddhism. The concept of divine being can only be found in Mahayana, one of the sects of Buddhism which had been distorted by China many many years ago. That means, the Guan Yin deity my mum has been worshipping for so many years was actually just a myth!
So, my mum has been clinging on the idea that she owed divine power a favour for receiving numerous ‘divine’ help throughout her lifetime. How i wish i could proudly tell her that she is one hell of a capable mum and she did it purely from her own great effort while Guan Yin granting wishes was nothing but myths. But it would be extremely cruel for me to shatter her good faith on Guan Yin by telling her that she has been living in delusion for the past 20 to 30 years or so. I couldn’t do it.
If this could happen to my mum, it could easily happen to other people with other faiths. For some funny reasons, psychologically, human love to cling on ‘hope’, just like small children always clinging on their parents. You could see it is a very natural thing for human to believe in supernatural power especially when we face adversity.
Q: You mentioned about psychology. Can you explain more about the psychological factor?
You know there’s an interesting psychological condition in human being where we are always happy to be fooled or manipulated by things which will make us happy or satisfied. Just like people who like to watch magic show who already knew it is just all tricks. We know those are pure tricks, yet we still want to be amused by the so called magic. Same goes when we watch movies, reading fiction books, or comics and manga. We know the stories were scripted and are not real, yet very often we put fourth our emotions and immerse ourselves in these activities. You know those moments when the hero triumph over the evil or when the leading actress died of illness resulting a sad ending to the movie? Those are the typical moment when our emotions will skyrocket. People cry, laugh, fear, thrilled, and get angry along with the movie they watch or books which they read. It is as though subconsciously, we perceive them as Real …
Think about it, doesn’t it amaze you that many people are committing the same kind of emotions to God who they have never seen before with their own eyes? God has never appeared before us, yet many people are devoted and strongly believe in Him. There are many people who could sacrifice their life in the name of God. These people basically think He is Real.
Could you see the parallel comparison?
Q: Woah, that’s really deep. So, what will you do to change religious people’s mind that God is not real?
Me: Human are always resistant to changes especially when it has already firmly became their mind-set or belief system. Nobody, absolutely nobody can change their mind. Only they themselves can realize it and change their own mind.
I love how Richard Dawkins put the title The God Delusion to his book. I think delusion is absolutely the perfect word to describe it. You know, when a girl first fall in love with a boy and she thinks that he will be her first and last and only later on realized that he is not the one? That’s delusion. Or perhaps some contestants who went for auditions in American Idol and think that they will become the next big thing only to be mocked by Simon? That’s also delusion.
So yes, as i see it, believing in God is a delusion. Only you yourself could realize delusions…. nobody can help you.
Q: So is it safe for me to assume that you totally rule out the possibility of God’s existence.
Me: It depends on what type of God you are referring to. We may be created by aliens who threw us here on planet Earth as part of their own experiment in creating intelligent life. In this sense, the aliens will be our God. Or perhaps, we are living in a Matrix world where our existence is just a computer simulation. Now in this case, the computer will be our God. You never know. There are boundless of possibilities on what brought us to existence. Until the day we know the answer, every possible God options we have right now is a good possibility.
But at the moment, i’m extremely skeptical to God (or Gods) from Abrahamic religions. Having saying that, i do not 100% rule out the possibility it may exist, just like i can’t rule out that Aliens exist.
Q: Thanks for conversation. Hopefully we will meet again.
Me: Yeap, talk soon.
PS: (This is a self interview session.)
Genetics & Cells
As we know, the core of every computer is bits of 0s and 1s. When a program send out instructions in 0s and 1s, the computer will read it and execute the task accordingly (basically computer software communicate with the hardware by 0s and 1s). Even when we move the mouse, the instructions will be sent to the computer in the form of 0s and 1s too. Reading a computer instruction will be something like this:
11010101011100101010111101010101101
00001101010101010110101001010101101
……………………………………………………
Apparently, even our body works in a similar way too. The source-code of human body is made up of four elements – A,C,T and G. Reading our genetic code will be something like this:
TCAGGACGCTTACATGACCTGACGGTAGCG
AGGGTCAACTCGAGCCTAACGTTACGGATC
…………………………………………….
A large chunk of codes were copied over from our parents to us and these codes will act as instructions to our body in our lifetime. And this genetic code will act as a script to our life. Human being basically have 3 billion based pair of DNA in our body.
It is obvious that there are several natural phenomenon within human body which are triggered by genetics. For example:
- Our gender.
- Puberty.
- Hereditary diseases such as heart attack and diabetes.
- Balding.
- Baby’s instinct (eg. seeking mother’s milk and mimicking words from adults).
- Body type (ectomorphic, endomorphic, and mesomorphic)
- Our look hence, our beauty.
- etc.
These are the things that you can’t reject as you have absolutely no free-will on them. If your body gives out the instruction that puberty will hit you when you’re 12 years old, that’s when your sexual organs will start to develop. You simply can’t avoid it. (unless you use external factors to interfere, eg. chemicals)
Same goes for hereditary diseases. If you are inherited with the disease, it will stick with you for the rest of your life. If your family has history of heart diseases, you will most likely be born with a weaker heart compared to other people. It is all written in the genetic script. With the current technology, you can only minimize the effect of the disease, but you can’t totally annihilate it. It’s scary because it is as though we have a time bomb in our body – We do not know when it will activate.
We have cloned our very first animal roughly 10 years ago – A sheep called Dolly. After the so called ‘accomplishment’, many other animals have been cloned such as horse and bull. However, until this day, it is still a controversial subject to clone human being despite several organizations declaring that they have successfully done it. The world is just not ready to openly accept such breakthrough.
The existing cloning technique being widely use is called Somatic Cell Nuclear Transfer.
The term somatic cell nuclear transfer refers to the transfer of the nucleus from a somatic cell to an egg cell. A somatic cell is any cell of the body other than a germ (reproductive) cell. An example of a somatic cell would be a blood cell, heart cell, skin cell, etc..
In this process, the nucleus of a somatic cell is removed and inserted into an unfertilized egg that has had its nucleus removed. The egg with its donated nucleus is then nurtured and divides until it becomes an embryo. The embryo is then placed inside a surrogate mother and develops inside the surrogate.
There are several cases where scientists played around genetics code with animals. For instance, by modifying the code, scientist managed to create a chicken with 2 pair of wings and 2 tails for a lizard instead of one. They do indeed look like some strange creature.
Future Genetics Engineering
At the current stage, scientists have just barely scratched the surface of genetics. Scientists have been implementing genetics engineering on plants (corns) to boost food output and natural resistance. (And this activity does receive many oppositions). At moment, through genetic screening, there is an ongoing research on cow’s milk production. I think, we can expect genetics of farm cows to be modified few years from now to produce more milk.
So what can genetic engineering do for human in the future? Once we have a great deal of understanding in genetics, the future of genetics engineering allows the possibility of repairing birth defects in every human being such as visual and hearing impairment, removal of hereditary diseases, mental problems and etc. Not only that, there are some controversial traits which are label as ‘defects’ which also can be altered – such as homosexuality and low intelligence.
I have lost the source, but apparently scientists have managed to find a particular genetic cell which determine a rat’s interest in opposite sexes. By just altering this genetic cell, scientist were able to breed a group of homosexual rats.
Yes, i can tell you we are just as superficial as the rats. However, human’s genetic has a more great deal of complexity therefore, scientists are still struggling to understand the structure of our genetics.
My Philosophical Implication of Genetics
1. Just like people who are not born good looking and can’t do anything to change their looks and beauty, isn’t it sad to tell people that you cannot do anything with your intelligence too? But you may ask, what about using cosmetics or plastic surgery to enhance the beauty? That would make one look beautiful too.
I agree, and this shows that you can do something about it to make yourself better via external factors.
I have made my argument several posts ago that most people today are striving to be ’smart’ not so much on being ‘intelligent’ because you can make yourself a smart person, but you can never make yourself to be a genius. The environmental factor is basically what make you smart. The structure of our brains were already determined from the moment we were born, hence representing the capacity of our intellect. This is simply a part of our genetics.
Not only that, once you understand genetics, you will realize even our emotions seems to be unreal – What makes you happy, sad, fear, anxious and so on. For example, we always think love is real and magical. However, once you peer deeply into human psychology and biology, you can’t help but to think love is just more of a body and mind reaction. After all, love is just an illusion. If everybody falls in love, what makes you think your love is so super special compared to others? Yet, almost every man thinks that his girlfriend/wife is the best in the world. Is it not crude for me to say that our mind tricked us via emotions?
2. To think that human are made up of mere codes certainly give us the feeling of fragility. Just mess up a small fraction of our codes, and we will screwed up some cells, hence undergoing a mutation process (which means getting cancer or some defects). Everything about us is governed by genetics including our health, our looks, the level of our intelligence, our skin colour, etc.
Since we have already been cloning sheep and some other animals, i wonder will it come a day where we will be able to clone super human being? (That will be the day where scientists have mastered the art of genetics) Perhaps we could extract DNA from Einstein’s brain, which is still preserved, and clone out mini-Einstein to conceive more crazy scientific ideas for humanity. And what if this technology drop to hands of evil organizations? They might dig the grave of Adolf Hitler, extract his DNA, and clone out mini-Hitler. Better still, they may even converge the DNA of Einstein and Hitler together to create a genius tyrant who will be unstoppable in conquering the world. I’m sure this will make hell of a science fiction story.
Ok, but seriously, genetic engineering has so much potential that it may even allow us to ‘customize’ human while it is still in embryo stage. For instance, if i want a child, even before it is born, i can already first determine the gender – Let’s say i pick female as the gender. Then i can choose to have a beautiful child by giving her the face features which are most often seem attractive such as big eyes, long and pointy nose, sultry pout lips, high cheekbone, curvy body, etc. Next, i can choose to make her a prodigy gifted kid with super intelligence. I will determine her height, body mass (weight), hair colour, skin tone colour, etc. Heck, i can even give her 4 arms if i think that will make her look cool. Breaking into genetic codes is just like breaking into an open-source computer software source codes – we can modify anything and make it work. We have to be aware not to make it ‘buggy’ though.
3. Certain organization are interested to revive extinct animals back such as Tasmanian Tiger. It is possible to revive back the species because the body of the last Tasmanian Tiger is still preserved, hence its DNA genes could be extracted for cloning purposes. This indeed amazed me. We were the one who drove Tasmanian Tiger to extinction, yet now, we are the one who will gonna revive them. We are just like … a God.
Biblical sources said that only God has the power to create human being, giving us intelligence, emotions and consciousness. But i believe, the secret code of genetics, alongside neuroscience, will be broken into someday one day. I strongly envision a future where we will be able to create human from scratch. According to Wikipedia, the composition of our human body are:
Oxygen, Carbon, Hydrogen, Nitrogen, Calcium, Phosphorus, Potassium, Sulfur, Chlorine, Sodium, Magnesium, Iron, Cobalt, Copper, Zinc, Iodine, Selenium, Fluorine. Our cells are mainly made up of Water.
That means, the materials which make up all of us are just around us and we could easily obtain all these elements to create an artificial body. To activate the body, we will need to program and configure the DNA of the body and transplanting memory to the brain. Having said that, i think we are still very far far away from doing these stuffs. But it is a possibility.
Putting it very metaphorically, genetics not only allow human to ‘read the mind of God’, but also giving us the capacity to become ‘the God’. But thinking about it, if human one day are able create another human from scratch, then what’s so spectacular about God’s ability?
So, what do i think of human being? I think human being is just a conscious-organic-robot.
PS: My next post will touch on Neuroscience.
Not Perfect Is Good
“Immaculate being?
In this secular existence, perfection is illusion. Regardless of all those who utter the contrary, this is the reality. Common man seeks it out … they aspire to achieve it, as if it were some tangible things.
But the fact of the matter is, perfection is an hollow shell. It is … devoid of any substance. I spit on perfection.
Perfection afterall, implies that you have reached the summit. No trial and error… no ability to conceptualize. An omniscient being would have no need for such superfluous things. For people who dabble in the sciences such as yourself, perfection would render you obsolete.
Many magnificent things have been, and will continue to come into existence. And yet, every last one of them will fall short of perfection’s finish line. Our function as men of science relies on their shortcomings, and then, only then can we apply the fruits of our labor.
To put it simply …. As soon as you began spouting that nonsense about being immaculate being, your fate was sealed. How dare you call yourself a man of science….” - Mayuri Kurotsuchi, a Shinigami mad-scientist, while eternally paralyzing and torturing another scientist, Szayel Aporro from Espada. Szayel earlier revived himself from death, and called his immortality technique perfect. - [Bleach (manga), Chapter 306]
Space Travel
I’ve personally uploaded this video to YouTube because i think what Michio Kaku and Neil deGrasse Tyson were explaining are pretty interesting.
Watch out for the last 2 minutes of the video.
The Perceived Value
Disclaimer: I use very strong generalization in this post. Please read with an open mind.
James Watson, a Nobel laureate and the co-discoverer of DNA, created a huge controversy several months ago when he said that Africans intelligence is averagely lower than normal people. Predictably, he was flak especially by the Black people community accusing him of making racist allegations.
So, we have people denying statement from a Nobel laureate scientist and called his statement crap. Now, i do not know how good James Watson is or how strong his tests were to make such statement but i would like to give the benefit of doubt to someone who found DNA and have more knowledge about genetics and science than a typical average person do.
Unless you can logically refute the subject with convincing argument, being skeptical do not automatically make you right. It’s clearly an emotional defensive-stance from these people. We, human always have the impulse to repel any negativity that we dislike which go against our ideology. Don’t believe? Walk to an atheist and yell to him that Almighty God created human being and you will see a very impulsive defensive-reply. I know i will.
I have read several articles about racial intelligence and the verdict is pretty mixed. Some scientists said there are no differences in intelligence between races, while other scientists claimed there are gaps between races. Therefore, we still do not conclusively know the answer yet.
Don’t get me wrong, the purpose of this post is not to point out that Black people are less intelligent than White people or implying that black people are inferior. I think it is ridiculous to say that any race is inferior. What i’m interested at is – why people take offense when there are negative allegations concerning their intelligence? Is being less intelligent such a severe issue?
This is my argument, but first, i will draw up 2 generalization statements.
1.White people generally are smarter than Black people. (most of the great scientists, thinkers, and inventors in history were White people)
2.Black people are generally stronger and fitter than the Whites physically. (most of the great and legendary athletes and sportsman today are Black people)
Now, this is a very interesting point i noticed – I think both statements amount to the same degree of biasness. But most people will take more offense with the former statement compared to the latter one. Why so?
The answer is very simple. It’s due to the ‘Perceived Value’ of intelligence over strength in this contemporary era. We are living in a capitalism and knowledge economy where the ability to think signify our status in the society. The more intelligent you are, the more fame you will get, the more money you will earn, and the more respect you will garner. While for physical strength, we have practically substitute them with machineries. You can have zero brawn but as long as you have the brain, fortune will come to you.
That’s the reason why Intelligence is an extremely precious commodity today. While for strength, it has became a thing of the past and easily replaceable.
But wait a minute. What if we could reverse the time and go back to thousand years ago? What if we are at Sparta now? As we know, the Spartans practice eugenics, which they will throw away weak babies. Men and women who are physically frail will become an outcast. Only warriors with brute strength and courage will be praised and qualified enough to be the citizen of the nation and fit in to the army. Guess what will happen if you say now that White people are generally physically weaker than Black people? I’m sure the Spartans will not hesitate to smash your head into pieces to prove their strength.
More comparisons
I always believe men, generally, are more intelligent than women in conceiving big-world-changing-complex-ideas. Just refer to the history and notice that 99% of the great scientists, inventors, and philosophers are male. But does that means the ladies are inferior to men? Absolutely not. Empathy is one of the many traits which men generally severely lack off while it is innate to most female.
Again, it is all down to the ‘Perceived Value’. Empathy is perceived more as a manners or morality while conceiving big ideas is an ability. The society rate Intelligence as more valuable, hence creating an impression that the male species are superior.
I believe men and women are equal. But I don’t believe men and women are equal in the sense of “corresponding-equality”. It is more of ‘total-equality’. Clueless? I invented these crappy terms, so i will explain the meanings,.
1. Corresponding-equality : What men can do, women can too. There’s no gap between men and women and we are 100% precisely equal in every sense.
2. Total-equality : Men & Women have different sets of strengths & weaknesses. But when you sum up these plus and minus together, men and women are actually equal.
Most feminist movements are championing the corresponding-equality ideology. I do not agree with their philosophy because i think it will take away the uniqueness of difference between men and women. Relationships are interesting because there are different ‘roles’ involved from both sides.
Conclusions.
Same goes for races, it is hard for me to imagine that we are corresponding-equal. I think each races has a different unique trait within us.
I would say Latin girls’ body are much busty and curvy compared to a typical Chinese girl. That explains why many supermodels we have today are mostly Latin related. So, does it mean it is a disaster to be born as a Chinese girl? No, i’m sure there are areas where Chinese girls are better than Latin girls, but perhaps that ability is overlook by the society.
The nature do not discriminate people from the start. Everyone’s talents and potentials are varied and like it or not, some of these potentials were already imprinted even before birth in our genetics.
‘Perceived Value’ is something dictate by the society. The mass society will decide whether this or that are important or not. When this happens, people who possess such ability or talent which fall under the high ‘Perceived Value’ category will get benefited the most.
Law of Thermodynamics
First Law of Thermodynamics
Putting it simply – Energy cannot be created out of nothing and cannot be destroyed to nothing.
The basic idea here is you can manipulate energy to change from one form to another – for example, using electricity to boil water (heat) or burning petrol to move a car. Or even converting energy to matter and vice versa.
As i have said, energy and matter cannot be totally destroyed. Many times, matter and energy were merely ‘transforming’ from one form to another. Let’s take a scenario for instance – you want to eliminate all evidences on a piece of paper. So you take a lighter, ignite the paper and burn the paper to ashes. From our human perspective, we have practically destroyed the paper. But from physics point of view, the paper has just undergone a transmutation process. The amount of energy and matter mass before and after the paper was burn will always be the same. This is called the equivalent principle.
Basically:
Mass of Paper + Mass of Fire (Lighter) + Mass of Oxygen = Mass of Ashes + Mass of Carbon Dioxide + Mass of other after-burn gases (Smoke) + etc.
Therefore, the amount of energy we have since the first day when the universe was born (presuming from big bang) will always remain the same throughout the life span of the universe (billion of years). Energy will just keep on recycling and transforming to another forms over and over again.
Second Law of Thermodynamics
There are two implications from this law.
1. Centralized energy will always disperse and spread out.
2. The total amount of entropy (disorder) in the universe will always increases. Practically everything and anything.
The second law of thermodynamics deals with everyday human experience. Using back the example of burning paper, notice that whenever you light up a piece of paper, the fire will not just remain on a spot but will always spontaneously spread all over the paper. Likewise, the smoke will disperse to the surrounding instead of just remaining on a spot.
Hence, this process will lead to entropy. Basically, everything in this universe goes from order to disorder, but not the opposite. You can burn the paper to ashes, but not assembling back the ashes to a paper. Human will age and die. but you can’t revive the dead and vitalize the youth on a person. Everything seems to move in a single direction, dictate by cause and effect. (Unless we could reverse time)
Richard Feynman once questioned – Why do we remember the past but can’t remember the future? This is not a stupid question. I can tell you the implication is much deeper than we think it is.
An example of Entropy: The Sun produces energy from nuclear fusion activities and shine light and heat across the galaxy because according to the Second Law of Thermodynamics, the heat, light and other form of energy must disperse. Therefore, the Sun will have to constantly produce energy to sustain the energy output in every moment. That means, someday one day, the resources on the sun will eventually deplete and run down.
Theoretically, if the Sun do not disperse energy, the Sun could live forever and will not die. (Though it is impossible not to disperse energy as everything has to obey the Second Law of Thermodynamics)
Third Law of Thermodynamics
Nothing can reach absolute zero temperature. That’s all i know about it =P.
Why is Thermodynamics important to our everyday life?
1. Understanding how matter and energy works.
2. I always believe that any philosophy which can be derived by observing how the nature work will be a good philosophy.
Random Recent Stuffs
1. My blog’s PageRank jumped from 0 to 5 overnight! I’m pretty sure it is some funny Google bugs. I mean, a blog with only averagely 70 clicks a day got a PR of 5? NooOo waay….
Anyway, i’m just using this blog as a personal journal to share some interesting thoughts with myself and my friends, and i surely do not intend to ‘market’ this blog to the public. Well, i’m glad some random people bumped into this blog (via search engine) and were pretty tolerant towards my average English. LoL.
2. I joined the first ever DotA tournament on last weekend and my team was pretty unfortunate to lose in the first round! Wrong strategy. Sucks.
I have never achieved anything big in gaming after ending up as a runner-up in a small Counter-Strike competition 7 years ago. Oh, time flies. I guess i’m a rusty gamer right now who just spend my time with my PlayStation Portable playing stupid games. Haha. Should i get myself a Wii? Fun!
3. My internship with MindValley was over last week. Not only it is the coolest place to work in Malaysia, also I’m really glad to have such opportunity to work for them.
February was certainly the most productive month for myself in the office in terms of learning as they have now the weekly Tuesday + Thursday meetings. Let’s see what i can do with the stuffs i have learned and came across. I wish them all the best.
4. Bought 3 new books – Insights of Genius (Art & Science), Stumbling on Happiness and 4 Hour Workweek. All of these books are genuinely good stuffs. Currently also reading books on Adolf Hitler. Another great stuff. He is more than just a tyrant, he is a brilliant dark-thinker.
And btw, Michio Kaku is gonna release his new book – Physics of the Impossible next week! Oh, i can’t wait. I can’t waaaaaaaaaaaaaaaaait~~~
5. Thinking of attending Psychology classes in the future… just for fun…. if i could make enough money to provide myself such extend to do it.. haha.
