Struggling with Meaninglessness

searching meaning in meaninglessness

Archive for the ‘Genetics’ Category

Subconscious Survival

with 5 comments

A MEGA POST! Combining several scientific areas into one! In writing mood! RaWR~

Often, male tend to judge a female based on her outer appearance. What is the usual criteria of a beautiful woman to a man? They are usually long healthy hair, smooth and good skin texture, and nice curvy body. There’s always a reason behind this. But before we get into such psychological situation let’s look at the basics of how our biological body works first.

How The Body Maintain Itself.

Our body constantly self-rejuvenate by repairing and maintaining cells in our body. For instance we change our stomach lining every week once and we change our kidney every 3 weeks once (basically, every single cells in the mentioned organs will be totally replaced by new cells every few weeks). Our body usually rejuvenate perfectly for the first 25 years of our life but things will start to slide down once we are beyond 25 years old. That’s basically when we start to age or get old. Why do we age?

There’s a component called as ‘Telomeres’ in our cells which get shorter every time a particular cell splits. In other words, it will someday reach a point when the cell can no longer divide itself anymore. When we reach the age of 25-30, that will be the equilibrium stage where cells rejuvenation is balanced with the demand of the body. However, once you pass this age stage, the demand will start to overwhelm supply and gradually, certain part of the body will have to be neglected from being 100% rejuvenated. As more and more years pass by, more and more cells will not be able to be maintained and rejuvenated.  So, imagine if your skin is not rejuvenated properly, that’s when you will wrinkle. Imagine if your heart is not rejuvenated properly, that’s when you will be vulnerable to heart diseases. Same goes for other organs. Combine all these factors together, that’s the reason why a person’s body gets weaker as we age.

(The irony – if you exercise a lot, you will live healthier but not necessary longer because you damage your body faster when doing heavy workouts which will push your body to replace more cells. People who lived beyond 100 years old are usually the ones who have healthy diet and do not do much heavy exercising, hence explaining why most of the oldest people around the world are usually females.)

If a person has a disease, let’s say kidney or heart disease, the body will automatically focus all its attention on the damaged organ and repair it to prolong the life of the victim to ensure a possibility of survival. Since the resources of self-rejuvenation is limited, hence the lesser important organs will be neglected which are .. you might guess it right – the hair and skin (some sort of priority hierarchy. The vital organs are the primary priority while skin and hair are secondary in priority). In other words, when a person has a disease, his/her skin or hair will not be in top conditions due to the way of how our body works.

The Subconscious Trick

Many times, we ask ourselves, what is life’s ultimate goal or what is the purpose of our life. According to science, especially from biological point of view, our goal just like other animals and plants, is to reproduce or copulate to pass on the genes, creating offspring and ensuring the survival of species. Therefore, subconsciously, we will want to have the best partner to share our genes with each other to create offspring. It’s not surprising, we will always want to look for a healthy partner.

Hence, if a girl has a beautiful skin and hair, that subconsciously will tell the man that she is a healthy lady which in turn, make him consciously to be interested with her. If a girl does not have healthy skin, it subconsciously implies that either she is not really healthy or she is old, and a guy will less likely to be consciously interested because she will not be an ideal partner to create an offspring together.

(It’s common that a guy sometimes can’t explain why he is interested with his girl. It’s an unexplainable feeling. The reason is simple – because it has all been worked out by the subconscious mind.)

Needlessly to say, a guys obsession with a girls body (breast, hip and butt) is subconsciously due to her ability to carry the baby for 9 months (and beyond).

From here, you will get the idea that our subconscious and conscious mind are speaking two different languages yet they are still strongly linked with each other. (Freud and Jung said that dream is basically a way of how the subconscious mind try to communicate with us albeit in a semi-conscious way. That’s the reason why we have to interpret them properly.)

If the subconscious and conscious mind do not share the same form of language together, wouldn’t it be easy to fool our subconscious mind? For example – girls using make-up and push-up bras. We consciously know that girls ‘enhanced’ themselves, yet we are still attracted to them. That’s because our subconscious interpreted things wrongly, hence – fooled. I will illustrate to you another example of how our subconscious mind is fooled.

The ‘Healthy’ Food We Eat

Imagine you are living thousand years ago searching for food in the jungle. How do you know which food can be put into your mouth and eaten especially when you come across unknown fruits? You do not know, but most likely you will want to taste it first. Instinctively, you know (subconsciously) that an edible and healthy food is usually have some distinctive characteristics. Perhaps it will be sweet or fresh or crispy or juicy or tender. Whatever it is.

If the fruit smells bad, or taste bitter, basically anything which is counter-intuitive to a good food, that’s when we will most likely throw the fruit away. That’s how our subconscious mind interpret things to ensure we only put in healthy food into our stomach and prevent poisoning ourselves. (Even if we get poisoned, we have another mechanism to remove the poison from our body which is having a Diarrhea and defecate. Great wonder how the body works.)

However, in the modern times today, many food producers has ‘fooled’ our subconscious mind by introducing various form of ‘delicious’ unhealthy food such as chocolate, ice-cream, soft drinks, junk food, etc.

These form of food work really well to satisfy our taste bud and fooled our subconscious mind by making it thinking that we are consuming good food. But as we know, they are not healthy if frequently consumed. The fooled subconscious mind is not aware of that and keep encouraging people to eat more of those food because it thought the body is consuming healthy food…. just like how guys are attracted to girls on make-up and nice little tight outfit.

This is the way how our minds work by default. Of course, the extent of defining what’s beauty or good food may vary different from environment to environment but .. i hope you get the idea how our mind and body work together.

Written by elan85

June 18, 2008 at 11:18 pm

Teleportation – Quantum Entanglement

with 3 comments

I mentioned few posts ago, that teleportation is possible. So, how does Teleportation really works?

First, we need to go back to the history a little bit. Quantum teleportation exploits a bizarre properties of atoms derived from EPR Paradox which was initially proposed to kill off the probability factor in quantum mechanics.

Albert Einstein, who believed that ‘God do not play dice with the universe’ (in other words, he doesn’t believe in total randomness in quantum mechanics and reality), along with Poldosky and Rosen, conceived the EPR Paradox to show why quantum mechanics is wrong. Through a thought-experiment on two tangled electrons, they suggested that information is able to travel much faster than the speed of light, which is impossible, hence the existing quantum theory is wrong. (However, more experiment were conducted and eventually Einstein was proven somewhat, wrong with his idea).

Alright, forget all the details. The most important point here is that Einstein and friends had introduced a marvelous concept in quantum mechanics – tangled atoms separated by great distance. Einstein called it spooky-action-at-distance. Michio Kaku explained …

This means, in some sense, that what happens to us automatically affects things instantaneously in distant corners of the universe, since our wave functions were probably entangled at the beginning of time. In some sense there is a web of entanglement that connects distant corners of the universe, including us. – Michio Kaku (Physics of the Impossible)

quantum teleporation 

Ok, so now we know that at atomic level the whole universe is somehow connected in a big web. This is what i gonna do – I will teleport atom A to atom C’s location separated by a great distance. So, i will first look for an atom which starts out being entangled with atom C nearby around me. I found one, and let’s call it atom B. I will put atom A in contact with atom B, scan it, and transfer all the information content from A to B. I have now temporarily entangled atom A with atom B. But since B and C were originally entangled, the information of atom A will automatically be transferred to atom C.

Hence, atom A has now been teleported to atom C. However, it does not mean A has physically traveled to C. Rather, it means atom A has been copied to atom C. Something like a duplication. So, what will happened to atom A? Atom A will self-destruct so that we don’t have two copies after the teleportation. (Using computing analogy, it is something like cut and paste rather than copy and paste)

Bear in mind quantum entanglement is not just a mere theory but it has already been tested and implemented. Scientists have teleported photons of light and gas of cesium atoms (which have trillions of atoms) using quantum entanglement. The teleportation distances are 600 meters and half a yard respectively.

Teleportation For Human Being using Quantum Entanglement.

Alright, the atom example above may sound confusing to you (quantum mechanics IS confusing, anyway). But i suppose it would be more clearer to use human being as an example.

As mentioned, in quantum entanglement, you do not really physically, ‘travel’ from one point to another, but rather a cut-and-paste technique is used to move you to the other side instead. This means that anyone being hypothetically teleported would die in the process.

Let’s say you want to teleport yourself to the moon. According to the existing theory, you can’t teleport and bring your entire body to the moon. So this is when bio-digital cloning comes into play.

You will send the information of every atoms in your whole body (which is 10^28 atoms = 100,000,000,000,000,000,000,000,000,000) to the moon and then through bio-digital cloning, your body would be reconstructed again with precision.Yes, your original body will die off and you would live in a new body carrying all the previous ‘data’ (memories) with you.

Conclusion: In atomic scale, teleportation is already a reality today. This simply means the law of physics allow teleportation. However, it is another story altogether of teleporting macroscopic object such as human being as it involves way too many numbers of atoms. So, until we master the art of quantum mechanics, genetic engineering and having a super quantum computing technology, teleporting human being is still not possible, yet. Time will certainly bring the technology closer to us.

Written by elan85

May 2, 2008 at 7:25 pm

Genetics & Cells

with 5 comments

As we know, the core of every computer is bits of 0s and 1s. When a program send out instructions in 0s and 1s, the computer will read it and execute the task accordingly (basically computer software communicate with the hardware by 0s and 1s). Even when we move the mouse, the instructions will be sent to the computer in the form of 0s and 1s too. Reading a computer instruction will be something like this:

11010101011100101010111101010101101

00001101010101010110101001010101101

……………………………………………………

Apparently, even our body works in a similar way too. The source-code of human body is made up of four elements – A,C,T and G. Reading our genetic code will be something like this:

TCAGGACGCTTACATGACCTGACGGTAGCG

AGGGTCAACTCGAGCCTAACGTTACGGATC

…………………………………………….

A large chunk of codes were copied over from our parents to us and these codes will act as instructions to our body in our lifetime. And this genetic code will act as a script to our life. Human being basically have 3 billion based pair of DNA in our body.

It is obvious that there are several natural phenomenon within human body which are triggered by genetics. For example:

  • Our gender.
  • Puberty.
  • Hereditary diseases such as heart attack and diabetes.
  • Balding.
  • Baby’s instinct (eg. seeking mother’s milk and mimicking words from adults).
  • Body type (ectomorphic, endomorphic, and mesomorphic)
  • Our look hence, our beauty.
  • etc.

These are the things that you can’t reject as you have absolutely no free-will on them. If your body gives out the instruction that puberty will hit you when you’re 12 years old, that’s when your sexual organs will start to develop. You simply can’t avoid it. (unless you use external factors to interfere, eg. chemicals)

Same goes for hereditary diseases. If you are inherited with the disease, it will stick with you for the rest of your life. If your family has history of heart diseases, you will most likely be born with a weaker heart compared to other people. It is all written in the genetic script. With the current technology, you can only minimize the effect of the disease, but you can’t totally annihilate it. It’s scary because it is as though we have a time bomb in our body – We do not know when it will activate.

We have cloned our very first animal roughly 10 years ago – A sheep called Dolly. After the so called ‘accomplishment’, many other animals have been cloned such as horse and bull. However, until this day, it is still a controversial subject to clone human being despite several organizations declaring that they have successfully done it. The world is just not ready to openly accept such breakthrough.

The existing cloning technique being widely use is called Somatic Cell Nuclear Transfer.

The term somatic cell nuclear transfer refers to the transfer of the nucleus from a somatic cell to an egg cell. A somatic cell is any cell of the body other than a germ (reproductive) cell. An example of a somatic cell would be a blood cell, heart cell, skin cell, etc..
In this process, the nucleus of a somatic cell is removed and inserted into an unfertilized egg that has had its nucleus removed. The egg with its donated nucleus is then nurtured and divides until it becomes an embryo. The embryo is then placed inside a surrogate mother and develops inside the surrogate.

(http://biology.about.com)

There are several cases where scientists played around genetics code with animals. For instance, by modifying the code, scientist managed to create a chicken with 2 pair of wings and 2 tails for a lizard instead of one. They do indeed look like some strange creature.

Future Genetics Engineering

At the current stage, scientists have just barely scratched the surface of genetics. Scientists have been implementing genetics engineering on plants (corns) to boost food output and natural resistance. (And this activity does receive many oppositions). At moment, through genetic screening, there is an ongoing research on cow’s milk production. I think, we can expect genetics of farm cows to be modified few years from now to produce more milk.

So what can genetic engineering do for human in the future? Once we have a great deal of understanding in genetics, the future of genetics engineering allows the possibility of repairing birth defects in every human being such as visual and hearing impairment, removal of hereditary diseases, mental problems and etc. Not only that, there are some controversial traits which are label as ‘defects’ which also can be altered – such as homosexuality and low intelligence.

I have lost the source, but apparently scientists have managed to find a particular genetic cell which determine a rat’s interest in opposite sexes. By just altering this genetic cell, scientist were able to breed a group of homosexual rats.

Yes, i can tell you we are just as superficial as the rats. However, human’s genetic has a more great deal of complexity therefore, scientists are still struggling to understand the structure of our genetics.

My Philosophical Implication of Genetics

1. Just like people who are not born good looking and can’t do anything to change their looks and beauty, isn’t it sad to tell people that you cannot do anything with your intelligence too? But you may ask, what about using cosmetics or plastic surgery to enhance the beauty? That would make one look beautiful too.

I agree, and this shows that you can do something about it to make yourself better via external factors.

I have made my argument several posts ago that most people today are striving to be ’smart’ not so much on being ‘intelligent’ because you can make yourself a smart person, but you can never make yourself to be a genius. The environmental factor is basically what make you smart. The structure of our brains were already determined from the moment we were born, hence representing the capacity of our intellect. This is simply a part of our genetics.

Not only that, once you understand genetics, you will realize even our emotions seems to be unreal – What makes you happy, sad, fear, anxious and so on. For example, we always think love is real and magical. However, once you peer deeply into human psychology and biology, you can’t help but to think love is just more of a body and mind reaction. After all, love is just an illusion. If everybody falls in love, what makes you think your love is so super special compared to others? Yet, almost every man thinks that his girlfriend/wife is the best in the world. Is it not crude for me to say that our mind tricked us via emotions?

2. To think that human are made up of mere codes certainly give us the feeling of fragility. Just mess up a small fraction of our codes, and we will screwed up some cells, hence undergoing a mutation process (which means getting cancer or some defects). Everything about us is governed by genetics including our health, our looks, the level of our intelligence, our skin colour, etc.

Since we have already been cloning sheep and some other animals, i wonder will it come a day where we will be able to clone super human being? (That will be the day where scientists have mastered the art of genetics) Perhaps we could extract DNA from Einstein’s brain, which is still preserved, and clone out mini-Einstein to conceive more crazy scientific ideas for humanity. And what if this technology drop to hands of evil organizations? They might dig the grave of Adolf Hitler, extract his DNA, and clone out mini-Hitler. Better still, they may even converge the DNA of Einstein and Hitler together to create a genius tyrant who will be unstoppable in conquering the world. I’m sure this will make hell of a science fiction story.

Ok, but seriously, genetic engineering has so much potential that it may even allow us to ‘customize’ human while it is still in embryo stage. For instance, if i want a child, even before it is born, i can already first determine the gender – Let’s say i pick female as the gender. Then i can choose to have a beautiful child by giving her the face features which are most often seem attractive such as big eyes, long and pointy nose, sultry pout lips, high cheekbone, curvy body, etc. Next, i can choose to make her a prodigy gifted kid with super intelligence. I will determine her height, body mass (weight), hair colour, skin tone colour, etc. Heck, i can even give her 4 arms if i think that will make her look cool. Breaking into genetic codes is just like breaking into an open-source computer software source codes – we can modify anything and make it work. We have to be aware not to make it ‘buggy’ though.

3. Certain organization are interested to revive extinct animals back such as Tasmanian Tiger. It is possible to revive back the species because the body of the last Tasmanian Tiger is still preserved, hence its DNA genes could be extracted for cloning purposes. This indeed amazed me. We were the one who drove Tasmanian Tiger to extinction, yet now, we are the one who will gonna revive them. We are just like … a God.

Biblical sources said that only God has the power to create human being, giving us intelligence, emotions and consciousness. But i believe, the secret code of genetics, alongside neuroscience, will be broken into someday one day. I strongly envision a future where we will be able to create human from scratch. According to Wikipedia, the composition of our human body are:

Oxygen, Carbon, Hydrogen, Nitrogen, Calcium, Phosphorus, Potassium, Sulfur, Chlorine, Sodium, Magnesium, Iron, Cobalt, Copper, Zinc, Iodine, Selenium, Fluorine. Our cells are mainly made up of Water.

That means, the materials which make up all of us are just around us and we could easily obtain all these elements to create an artificial body. To activate the body, we will need to program and configure the DNA of the body and transplanting memory to the brain. Having said that, i think we are still very far far away from doing these stuffs. But it is a possibility.

Putting it very metaphorically, genetics not only allow human to ‘read the mind of God’, but also giving us the capacity to become ‘the God’. But thinking about it, if human one day are able create another human from scratch, then what’s so spectacular about God’s ability?

So, what do i think of human being? I think human being is just a conscious-organic-robot.

PS: My next post will touch on Neuroscience.

Written by elan85

March 16, 2008 at 6:07 pm

Posted in Genetics, Philosophy