Genetics & Cells

As we know, the core of every computer is bits of 0s and 1s. When a program send out instructions in 0s and 1s, the computer will read it and execute the task accordingly (basically computer software communicate with the hardware by 0s and 1s). Even when we move the mouse, the instructions will be sent to the computer in the form of 0s and 1s too. Reading a computer instruction will be something like this:

11010101011100101010111101010101101

00001101010101010110101001010101101

……………………………………………………

Apparently, even our body works in a similar way too. The source-code of human body is made up of four elements – A,C,T and G. Reading our genetic code will be something like this:

TCAGGACGCTTACATGACCTGACGGTAGCG

AGGGTCAACTCGAGCCTAACGTTACGGATC

…………………………………………….

A large chunk of codes were copied over from our parents to us and these codes will act as instructions to our body in our lifetime. And this genetic code will act as a script to our life. Human being basically have 3 billion based pair of DNA in our body.

It is obvious that there are several natural phenomenon within human body which are triggered by genetics. For example:

• Our gender.
• Puberty.
• Hereditary diseases such as heart attack and diabetes.
• Balding.
• Baby’s instinct (eg. seeking mother’s milk and mimicking words from adults).
• Body type (ectomorphic, endomorphic, and mesomorphic)
• Our look hence, our beauty.
• etc.

These are the things that you can’t reject as you have absolutely no free-will on them. If your body gives out the instruction that puberty will hit you when you’re 12 years old, that’s when your sexual organs will start to develop. You simply can’t avoid it. (unless you use external factors to interfere, eg. chemicals)

Same goes for hereditary diseases. If you are inherited with the disease, it will stick with you for the rest of your life. If your family has history of heart diseases, you will most likely be born with a weaker heart compared to other people. It is all written in the genetic script. With the current technology, you can only minimize the effect of the disease, but you can’t totally annihilate it. It’s scary because it is as though we have a time bomb in our body – We do not know when it will activate.

We have cloned our very first animal roughly 10 years ago – A sheep called Dolly. After the so called ‘accomplishment’, many other animals have been cloned such as horse and bull. However, until this day, it is still a controversial subject to clone human being despite several organizations declaring that they have successfully done it. The world is just not ready to openly accept such breakthrough.

The existing cloning technique being widely use is called Somatic Cell Nuclear Transfer.

The term somatic cell nuclear transfer refers to the transfer of the nucleus from a somatic cell to an egg cell. A somatic cell is any cell of the body other than a germ (reproductive) cell. An example of a somatic cell would be a blood cell, heart cell, skin cell, etc..
In this process, the nucleus of a somatic cell is removed and inserted into an unfertilized egg that has had its nucleus removed. The egg with its donated nucleus is then nurtured and divides until it becomes an embryo. The embryo is then placed inside a surrogate mother and develops inside the surrogate.

(http://biology.about.com)

There are several cases where scientists played around genetics code with animals. For instance, by modifying the code, scientist managed to create a chicken with 2 pair of wings and 2 tails for a lizard instead of one. They do indeed look like some strange creature.

Future Genetics Engineering

At the current stage, scientists have just barely scratched the surface of genetics. Scientists have been implementing genetics engineering on plants (corns) to boost food output and natural resistance. (And this activity does receive many oppositions). At moment, through genetic screening, there is an ongoing research on cow’s milk production. I think, we can expect genetics of farm cows to be modified few years from now to produce more milk.

So what can genetic engineering do for human in the future? Once we have a great deal of understanding in genetics, the future of genetics engineering allows the possibility of repairing birth defects in every human being such as visual and hearing impairment, removal of hereditary diseases, mental problems and etc. Not only that, there are some controversial traits which are label as ‘defects’ which also can be altered – such as homosexuality and low intelligence.

I have lost the source, but apparently scientists have managed to find a particular genetic cell which determine a rat’s interest in opposite sexes. By just altering this genetic cell, scientist were able to breed a group of homosexual rats.

Yes, i can tell you we are just as superficial as the rats. However, human’s genetic has a more great deal of complexity therefore, scientists are still struggling to understand the structure of our genetics.

My Philosophical Implication of Genetics

1. Just like people who are not born good looking and can’t do anything to change their looks and beauty, isn’t it sad to tell people that you cannot do anything with your intelligence too? But you may ask, what about using cosmetics or plastic surgery to enhance the beauty? That would make one look beautiful too.

I agree, and this shows that you can do something about it to make yourself better via external factors.

I have made my argument several posts ago that most people today are striving to be ‘smart’ not so much on being ‘intelligent’ because you can make yourself a smart person, but you can never make yourself to be a genius. The environmental factor is basically what make you smart. The structure of our brains were already determined from the moment we were born, hence representing the capacity of our intellect. This is simply a part of our genetics.

Not only that, once you understand genetics, you will realize even our emotions seems to be unreal – What makes you happy, sad, fear, anxious and so on. For example, we always think love is real and magical. However, once you peer deeply into human psychology and biology, you can’t help but to think love is just more of a body and mind reaction. After all, love is just an illusion. If everybody falls in love, what makes you think your love is so super special compared to others? Yet, almost every man thinks that his girlfriend/wife is the best in the world. Is it not crude for me to say that our mind tricked us via emotions?

2. To think that human are made up of mere codes certainly give us the feeling of fragility. Just mess up a small fraction of our codes, and we will screwed up some cells, hence undergoing a mutation process (which means getting cancer or some defects). Everything about us is governed by genetics including our health, our looks, the level of our intelligence, our skin colour, etc.

Since we have already been cloning sheep and some other animals, i wonder will it come a day where we will be able to clone super human being? (That will be the day where scientists have mastered the art of genetics) Perhaps we could extract DNA from Einstein’s brain, which is still preserved, and clone out mini-Einstein to conceive more crazy scientific ideas for humanity. And what if this technology drop to hands of evil organizations? They might dig the grave of Adolf Hitler, extract his DNA, and clone out mini-Hitler. Better still, they may even converge the DNA of Einstein and Hitler together to create a genius tyrant who will be unstoppable in conquering the world. I’m sure this will make hell of a science fiction story.

Ok, but seriously, genetic engineering has so much potential that it may even allow us to ‘customize’ human while it is still in embryo stage. For instance, if i want a child, even before it is born, i can already first determine the gender – Let’s say i pick female as the gender. Then i can choose to have a beautiful child by giving her the face features which are most often seem attractive such as big eyes, long and pointy nose, sultry pout lips, high cheekbone, curvy body, etc. Next, i can choose to make her a prodigy gifted kid with super intelligence. I will determine her height, body mass (weight), hair colour, skin tone colour, etc. Heck, i can even give her 4 arms if i think that will make her look cool. Breaking into genetic codes is just like breaking into an open-source computer software source codes – we can modify anything and make it work. We have to be aware not to make it ‘buggy’ though.

3. Certain organization are interested to revive extinct animals back such as Tasmanian Tiger. It is possible to revive back the species because the body of the last Tasmanian Tiger is still preserved, hence its DNA genes could be extracted for cloning purposes. This indeed amazed me. We were the one who drove Tasmanian Tiger to extinction, yet now, we are the one who will gonna revive them. We are just like … a God.

Biblical sources said that only God has the power to create human being, giving us intelligence, emotions and consciousness. But i believe, the secret code of genetics, alongside neuroscience, will be broken into someday one day. I strongly envision a future where we will be able to create human from scratch. According to Wikipedia, the composition of our human body are:

Oxygen, Carbon, Hydrogen, Nitrogen, Calcium, Phosphorus, Potassium, Sulfur, Chlorine, Sodium, Magnesium, Iron, Cobalt, Copper, Zinc, Iodine, Selenium, Fluorine. Our cells are mainly made up of Water.

That means, the materials which make up all of us are just around us and we could easily obtain all these elements to create an artificial body. To activate the body, we will need to program and configure the DNA of the body and transplanting memory to the brain. Having said that, i think we are still very far far away from doing these stuffs. But it is a possibility.

Putting it very metaphorically, genetics not only allow human to ‘read the mind of God’, but also giving us the capacity to become ‘the God’. But thinking about it, if human one day are able create another human from scratch, then what’s so spectacular about God’s ability?

So, what do i think of human being? I think human being is just a conscious-organic-robot.

PS: My next post will touch on Neuroscience.